miRNA Sequencing

Platform/Sequencing Center Data Generation Protocols Data Analysis Protocols
BC Cancer BLBurkitt Lymphoma Data Generation Protocol Icon BLBurkitt Lymphoma Data Analysis Protocol Icon

Data Generation Protocol

The data generation protocols for the Burkitt Lymphoma (BL) project were acquired from the following manuscript.

Grande BM, Gerhard DS, Jiang A, et al. Genome-wide discovery of somatic coding and non-coding mutations in pediatric endemic and sporadic Burkitt lymphoma.?Blood. March 2019; 21;133(12):1313-1324. ()

miRNA Sequencing

miRNA sequencing (miRNA-seq) libraries were constructed from 1 μg total RNA provided by Nationwide Children’s Hospital (Columbus, OH) using a plate-based protocol developed at the British Columbia Cancer, Genome Sciences Centre (BCGSC). Negative controls were added at three stages: elution buffer was added to one well when the total RNA was loaded onto the plate, water to another well just before ligating the 3’ adapter, and PCR brew mix to a final well just before PCR amplification. A 3’ adapter was ligated using a truncated T4 RNA ligase2 (NEB 212 Canada, cat. M0242L) with an incubation at 22°C for 1 hour. This adapter is an adenylated, single-stranded DNA with the sequence 5’ /5rApp/ ATCTCGTATGCCGTCTTCTGCTTGT/3ddC/, which selectively ligates to miRNAs. An RNA 5’ adapter was then ligated, using T4 RNA ligase (Ambion USA, cat. AM2141) and ATP, and was incubated at 37°C for 1 hour. The sequence of the single strand RNA adapter is 5’GUUCAGAGUUCUACAGUCCGACGAUCUGGUCAA3’.

7x彩票网邀请码Upon completion of adapter ligation, 1st strand cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen, cat.18064 014) and RT primer (5’-221 CAAGCAGAAGACGGCATACGAGAT-3’). First-strand cDNA provided the template for the final library PCR, into which we introduce index sequences to enable libraries to be identified from a sequenced pool that contains multiple libraries. Briefly, a PCR brew mix was made with the 3’ PCR primer (5’-CAAGCAGAAGACGGCATACGAGAT-3’), Phusion Hot Start HighFidelity DNA polymerase (NEB Canada, cat. F-540L), buffer, dNTPs and DMSO. The mix was distributed evenly into a new 96-well plate. A Microlab NIMBUS robot (Hamilton Robotics, USA) was used to transfer the PCR template (1st strand cDNA) and indexed 5’ PCR primers into the brew mix plate. Each indexed 5’ PCR primer, 5’AATGATACGGCGACCACCGACAGNNNNNNGTTCAGAGTTCTACAGTCCGA-3’,contains a unique six-nucleotide ‘index’ (shown here as N’s), and was added to each well of the 96-well PCR brew plate. PCR was performed at 98°C for 30 seconds, followed by 15 cycles of 98°C for 15 seconds, 62°C for 30 seconds and 72°C for 15 seconds, and finally a 5 minute incubation at 72°C. Library qualities were assessed across the whole plate using a Caliper LabChipGX DNA chip. PCR products were pooled and size selected to remove larger cDNA fragments and smaller adapter contaminants, using a 96-channel 235 automated size selection robot that was developed at the BCGSC. After size selection, each pool was ethanol precipitated, quality checked using an Agilent Bioanalyzer DNA1000 chip and quantified using a Qubit fluorometer (Invitrogen, cat. Q32854). Each pool was diluted to a target concentration for cluster generation and loaded into a single lane of an Illumina HiSeq2500 flow cell. Clusters were generated, and lanes were sequenced with a 31-bp main read for the insert and a 7-bp read for the index.

Data Analysis Protocol

The data analysis protocols for the Burkitt Lymphoma (BL) project were acquired from the following manuscript.

Grande BM, Gerhard DS, Jiang A, et al. Genome-wide discovery of somatic coding and non-coding mutations in pediatric endemic and sporadic Burkitt lymphoma.?Blood7x彩票网邀请码. March 2019; 21;133(12):1313-1324. ()

Gene expression quantification?

miRNA expression profiling was performed separately on the miRNA sequencing data using Canada’s Michael Smith Genome Sciences Centre miRNA processing pipeline, which was used for The Cancer Genome Atlas project.?The analysis was done using miRBase release 21.

Last updated: August 19, 2019